Review



nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt
    Nontargeting Scramble Shrna Sequence Oligonucleotide Gcgcgatagcgctaataattt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1233 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt/product/Addgene inc
    Average 96 stars, based on 1233 article reviews
    nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt - by Bioz Stars, 2026-05
    96/100 stars

    Images



    Similar Products

    nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt  (Addgene inc)
    96
    Addgene inc nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt
    Nontargeting Scramble Shrna Sequence Oligonucleotide Gcgcgatagcgctaataattt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt - by Bioz Stars, 2026-05
    96/100 stars
    		  Buy from Supplier
    scramble control  (Addgene inc)
    96
    Addgene inc scramble control
    Scramble Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scramble control/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    scramble control - by Bioz Stars, 2026-05
    96/100 stars
    		  Buy from Supplier
    plko 1 scramble shrna  (Addgene inc)
    96
    Addgene inc plko 1 scramble shrna
    Plko 1 Scramble Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 scramble shrna/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    plko 1 scramble shrna - by Bioz Stars, 2026-05
    96/100 stars
    		  Buy from Supplier
    plko 1 scramble cloning vector  (Addgene inc)
    96
    Addgene inc plko 1 scramble cloning vector
    Plko 1 Scramble Cloning Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 scramble cloning vector/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    plko 1 scramble cloning vector - by Bioz Stars, 2026-05
    96/100 stars
    		  Buy from Supplier

    Image Search Results